Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig3848

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig3848
Contigset
NSFT03P2 EST
Contig Members
BE424200
BQ841783
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE424200-3B
BE424200-3D
DNA
caccgggctgttccgctgcggtaagagctgccgcctccggtgggcgaacc
acctcaggcccacctcaagaagggggccttcacccccgaggaggagaggc
tcatcatccagctccactccaagatgggcaacaagtgggctcggatggcc
gctcatttgccagggcgtactgataatgaaataaagaattactggaacac
tcgaataaagagatgccagcgagctggcttgccaatatatcctgctagtg
tatgcaatcaatcttcaaatgaagatcagcagggctccagcgatttcaac
tgcggcgagaatctttccagtgaccttctgaatggaaatggtctttatct
gccagattttacctgtgacaatttcattgctaattcagaggctttatctt
atgcaccacagctttcagctgtttcaataagcagtttgcttggtcagagc
tttgcatccaaaaactgcggcttcatggatcaagtaaaccaagcagggat
gctaaaacagtctgaccctttactccctggattgagcgacaccatcaatg
gcgcgctctcctcggtcgatcagttctcaaatgactctgagaatctcaag
aaggctctgggttttgactatctccatgaagccaactctagcagcaagat
gattgcaccatttgggggtacacttactggcagccatgcctttttaaatg
gcaccttctctacttctaggaccatcaatggtcctttgaagatggagctc
ccttcactccaagataccgaatctgatc
BLAST
BLAST Search