Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig5143

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig5143
Contigset
NSFT03P2 EST
Contig Members
BG605580
BE517107
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
DNA
cgcggccgcgtcgacctctctcttacacaagttgctgctgagttggtgtt
gtccttgttcctggacggacacatccgacatgtcgacggcggtggcgcgg
cccttcggcgggttccccggatcggggaggaccaagggggatgagctgct
cggcaagaagatgagcgacgggttcttcatcgaggaggaggaggaagagg
aggcggaggaggtgctgacngagagctcctccatcggcgccccgtcgccg
tcgagctcctccatcggggaggactcctcgtcggaggttggcggggaagg
ggaggacgaggaggtgg
BLAST
BLAST Search