Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig5144

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig5144
Contigset
NSFT03P2 EST
Contig Members
BG605554
BQ841407
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BG605554-5B
BG605554-5A
DNA
ttcggcacgaggccgacgcgtacatgtcctacgccatgtccgtgctgctc
ggccgcgccctccccgacgtccgcgacgggctcaagccggtgcaccgccg
gatactctatgcaatgcatgaaatgggccttgcatctcgtaagccataca
gaaaatgtgccagagtcgttggtgaggtactcggtaaattccatcctcat
ggagattcagccgtctatgaaactttagtgcgaatggctcaggacttttc
aatgaggtacccacttgttcaaggacatggtaactttggttcaatagatg
ccgatcctcccgctgcaatgcgatacacagagtgccgcttggatccatta
acagaagccatgttcctgactgatttggagctgaatacagttgactacgt
tccgaacttcgataattcacagaaagaaccatctctgttgccagctcgtg
ttccatcactactattgaatggatcttctggaattgcagttggaatggcg
acaaatatccctccccacaatctgggagaacttgttgatgcactctctgc
tataattcaaaaccctgatgctacactccaagaactactggaatacatgc
ctggtcctgactttcctacaggagggatactcatgggaaatgatggtatt
ttggaggcctatagaactgggcgtggtcgaattgtgatgagaggcaaaac
cgtcatagaaacaattgatgagaaaaccaagcgcacggctatcataatta
atgaggttccgtaccagacaaataaatctactctagtccaaaggatagct
gagcttgttgaagacaaggtgttagaaggcatcagtgatattcgggatga
aagcgaccgtgctggaatgcgtgtagttatcgaggtgaaaagaggtgcaa
atcctgccattgtcctgaacaacctgtatcgtcatacagcattgcagtct
atttttagctgcaacatggtagctattcttgatgggcatccaaaactgat
gggactga
BLAST
BLAST Search