Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig5603

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig5603
Contigset
NSFT03P2 EST
Contig Members
BE517872
BQ165932
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
Probe
BE517872-2B
BE517872-2A
BE517872-2D
DNA
tttttttttttttttttttttttaataatccaccatggttctgcataata
acatgacaaatctgtctacaaaactaatccaacccctgataacagtttcc
gcatcaatgtcaagacggtttgtgaaacttaccgccaagttatatgactt
tgaaagcttcatcaacttcaatgataatccactgagcactctagtcctca
gagccagatcataaaaatcttgtcggaagtggaaagtaacactatcaata
ataactattctcacatctttatgttctccgaggaatttctccagatagtt
tatcaccgcaatctgttcagtgtagctgcatattcggaagtagtagattc
ctgccaggaaactctcgggctgcagattttcttggccagatgacgacttg
tcatggtggcatggaaaatactccattatgtcactgatgcacccttcagc
aatttgatagacgcgttcaaccatgaaactgccctctgtatcaatataaa
ttgctttgccgccaaggccaccatagtccacgggaaattggacgttgatt
gctagctgaatccccagttgagttttaccaattcctggaaccccacctat
ctcagtaacttctttacaatgaatccctccaccaagtatgccgttcaggt
caccagagccagtagtgatgtgtttctgtgattgctcctcagacagcata
tcccatgcattttgggctccttggaggagcagcttctgcgccgtctcgtt
gggagccatgtcgcattcgcggagcacggcgtaggcctcctcgtcggtgc
ggttcctggcgaccccctgctgtagtggtgtgtagattgtccg
BLAST
BLAST Search