Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig8362

[ Printable Version ]  [ Submit comment/correction ]

Sequence
NSFT03P2_Contig8362
Contigset
NSFT03P2 EST
Contig Members
CD453846
BE516706
BQ807185
Data at wEST
Contig annotation
Data Source
Chao, Shiaoman2003.01
DNA
gattcggcacgagggctgcttcagggagcctttcctttggagtgtgctgt
cggctcctttgccaaagagtgacccagttgatggtgtccctccaggatct
gcagataggccaaaggccctaaagcttgacagaagcccattgagccaagg
tagcacaaaattgaaaaagggcgagagagaaagggaccagagcagagatg
ggtctgccaagaactccagctcgaaatcaggcagcggccggaactcgtct
ggcagcggccggaacgagcgcaagaccaagatgaagccaaagcagaagct
agcgcagctatcaacatctggaaacgtccttggcagagtcacagagccat
ccaactccagcttcccatcaccgtcgccgcgagaatccaacgagtggaac
aaccctctgagcacaagacctacccagcaaccaaggaacagcgcggccaa
cgttgctccagagtccctggacgcccccatgaacctgccaccgatggacc
ccatggtggacatcctggacgtgccggagggcaacgacattagtgcctgg
ttcacggacggcctggacgactcgctgcaagactttgatttctccggagg
cctggagatcccggacgacgatctcacccagctagggttcatgtgagatg
agagctatagtaaatatcattatatatatgtgcatataattggatgattc
ttgatgctgtgttagcaagcgctgccttgctggtttgccgcactaaccac
cttagctgatgtaactaaccccaattggtattggtgagcatcatgaggtg
acagcatctattaatctgcagtttcagtcctgaaaaaaaaaaaaaaaaaa
aaaaaaa
BLAST
BLAST Search