Query (optional)   in Class  

GrainGenes Sequence Report: PBI25-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
PBI25-5
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data Source
Kuenzel, Gottfried98.05.05
Probe
PBI25
DNA Homology
N36274146noncereal_EST
[ Show all 50 ]
DNA
cgttgcattccgtcagtttccaacaaaccatagcaaagcatgaatgctcg
tgatcagataaaaaacacaaccacatgcaccgcttacggagaggccttat
gcccactctcctacagtactatttaccttttatatgcgcgcgttgctact
cgctcggcggagatgccaccgcgggcgacggcaacagggcggacnnvccg
ggcatcgactcgtggacgacggtgctggtggagaagaagatcggttcgac
gctcagccgcagcatcacggccccaaggacgtccgtcagcagcttcttga
actccgcttcctcgaccgccttcccgtcgccggcgtccgccaccttgagc
gtctcgtccacgacggcgtccacctgcgccacgttcagaaatcagaacca
tagaatcaaaaccatgctcattctccagtaa
BLAST
BLAST Search