Query (optional)   in Class  

GrainGenes Sequence Report: PSR105 Reverse

[ Printable Version ]  [ Submit comment/correction ]

Sequence
PSR105 Reverse
Data Source
Devos, Katrien M.01.05
Probe
PSR105
DNA
tcttccgcgcctccgtgccggctccagaccctacggctcaaccccgcgcg
acaccacgggctgtcgccggcgcctagagcggccaaggctgtggaggcag
ggaaggctgaccatctaaatgtcatgatagcgagagctcccagcgtcccg
ggaagggcacgcaggaggcctaatcaaggccaaatatggtctggtgcaca
tttcagctggagatttgttaagggcagaaatcgccacaggcactgacaat
gggaagcaggccaaggagtttatggagaagggacagctggttcctgacga
gatcgttgttaatatggtgaaggggcgtcttctgcaaccagatgctcagg
aaaagggttggcttttggatggttacccgagaagttattcacaggca
BLAST
BLAST Search