Query (optional)   in Class  

GrainGenes Sequence Report: PSR120 Reverse

[Submit comment/correction]

Sequence
PSR120 Reverse
Data Source
Devos, Katrien M.01.05
Probe
PSR120
DNA
ttttttttttttttacaataccatgtttgctattgctaagcacaaccaaa
atccatcaatacagaacaacacttgtaccaccagctcacagcgatccaag
gcatattttacatgctgaggcagtggcagattaagtgttttccttgagca
acatgttttttcttctcaagtggagcacacgtcactgctatcatttggtc
gatcttgaggaacaacctccgacacgtctacgacaccaactaatgttcca
cccctttcattcttaacatattgaaagaacaagtagttatcctctaaaac
gccgcaaactctggtcaagcagggcaccacaagttctaccttgatggtga
ttcgttacttgtgccagattttta

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.