Query (optional)   in Class  

GrainGenes Sequence Report: PSR129 Forward

[ Printable Version ]  [ Submit comment/correction ]

Sequence
PSR129 Forward
Data Source
Devos, Katrien M.01.05
Probe
PSR129
DNA
atgcctgcaggtcgactctagaggatccccgtttcccttgaggtcattgc
aatgagaacacctgggttcagtggagcagacctggcgaatcttctgaatg
aggcagccatattagcaggccgacgtgggaggacaggaatttcctcgaag
gagattgatgattcaatcgacagaatagtggctggtatggaaggaactgt
catgacagacgggaagagcaaaagccttgttgcttaccacgaagttgggc
atacagtttgcggaactttgacgcctggccatgaccccgtccagaaggtt
accttagttccaaggggtcaagcccgtggtctcacctggttcattcccat
gggatggaccc
BLAST
BLAST Search