Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c12151_582

[Submit comment/correction]

Sequence
RAC875_c12151_582
Contig
1BS_3434743
Species
Triticum aestivum
Probe
RAC875_c12151_582
DNA
GTCATCAGCATGTATGCTCTCAATCTCCTGCTAGGGTATTTTCTCTTAAA
YGATGCTACTGTCACATGATGCATATCATGGTTTTGTTGCGTGGTAATTT
G

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.