Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c12293_588

[Submit comment/correction]

Sequence
RAC875_c12293_588
Contig
5BL_10899750
Probe
RAC875_c12293_588
DNA Homology
5BL_10899750Best IWGSC match1397e-31URGI_BestIWGSC_N
BLAST, e-value
7e-315BL_10899750Best IWGSC match
DNA
ccttggatcatctcatcatcgactccttcaatgaaggactcgaattcatc
Rcccggtcctgctgatggggtccagttgaatggttgactaatctccatcc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.