Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c1256_85

[ Printable Version ]  [ Submit comment/correction ]

Sequence
RAC875_c1256_85
Contig
2DL_9894863
Species
Triticum aestivum
Probe
RAC875_c1256_85
DNA
ATAACCGTGCGATAACTAAATGACTGAGTTGGAGCACCGTGAAGAAACAT
Ratagtcccacgccgtgaatcaggagaacctgtttcgcctcacgaaccat
a
BLAST
BLAST Search