Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c14859_64

[Submit comment/correction]

Sequence
RAC875_c14859_64
Contig
4DS_936112
Probe
RAC875_c14859_64
DNA Homology
4DS_936112Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444DS_936112Best IWGSC match
DNA
aacttgaggagaagtttcctcgcgatggcaagccggtgaggaatttcgcc
Rctccgcgctctcttgggttatggggcaacggtgttttccgcccgccgcc
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.