Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c15190_1089

[Submit comment/correction]

Sequence
RAC875_c15190_1089
Contig
1BL_3905741
Probe
RAC875_c15190_1089
DNA Homology
1BL_3905741Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441BL_3905741Best IWGSC match
DNA
tgaaagaagaaaaggatatggggactggcgatccatcatttcctaaggct
Rtctggcctccaaaggcacgctgcccatcttgctatcgttcttcaagcag
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.