Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c21795_966

[Submit comment/correction]

Sequence
RAC875_c21795_966
Contig
7DL_3350087
Probe
RAC875_c21795_966
DNA Homology
7DL_3350087Best IWGSC match1764.99983e-42URGI_BestIWGSC_N
BLAST, e-value
4.99983e-427DL_3350087Best IWGSC match
DNA
gaatcatcrgagacctttatcactctgaatcctgtactcaactcgatgcc
Rtctctttggaactttgattcagcaaacacagctatcctttggtcaaacg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.