Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c29488_56

[Submit comment/correction]

Sequence
RAC875_c29488_56
Contig
5BL_10916533
Probe
RAC875_c29488_56
DNA Homology
5BL_10916533Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445BL_10916533Best IWGSC match
DNA
ggtaggtggcaggcgatgcaccatatgcttgatacggatgtgcagttgtg
Rtcacatagtaagcaggcgcggcgaattgagcagttggagcaggaaggtg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.