Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c29540_1109

[ Printable Version ]  [ Submit comment/correction ]

Sequence
RAC875_c29540_1109
Contig
1AL_1486071
Probe
RAC875_c29540_1109
DNA Homology
1AL_1486071Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441AL_1486071Best IWGSC match
DNA
agtctcaaacaagggtccagaatggaaatatcagttcgtactcagtttgt
Rtagcagattatcaaagtttgatttggctattaattaccgggttaccata
c
BLAST
BLAST Search