Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c33757_237

[Submit comment/correction]

Sequence
RAC875_c33757_237
Contig
1AL_3874571
Probe
RAC875_c33757_237
DNA Homology
1AL_3874571Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-421AL_3874571Best IWGSC match
DNA
gtagacaaaggcgagtcgggcgctggtagcggccatgttgccggagccgc
Rccggtgaagccgctcgcacctgacggccgtagttgcacgcctcatgcgt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.