Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c37515_369

[Submit comment/correction]

Sequence
RAC875_c37515_369
Contig
2BL_7962227
Probe
RAC875_c37515_369
DNA Homology
2BL_7962227Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BL_7962227Best IWGSC match
DNA
atgccgtaggaggggaaggagaggccgtcgtcgtcgtcgtccttgcatgg
Rgtacccccattcacacttcttggctgtctagttcgtcgtcgttcgttca
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.