Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c37654_203

[Submit comment/correction]

Sequence
RAC875_c37654_203
Contig
3AS_3446299
Species
Triticum aestivum
Probe
RAC875_c37654_203
DNA
ctatggcggcataaaggttgtgtagaaatcactcaagtctgctttttatt
Rtggaagctcgttgtatgtgtaaaattatttatactcttggtcccggcgc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.