Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c3964_752

[Submit comment/correction]

Sequence
RAC875_c3964_752
Contig
5AL_1591235
Probe
RAC875_c3964_752
DNA Homology
5AL_1591235Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445AL_1591235Best IWGSC match
DNA
atcttcagtgggagcatgagttgcaactggaaatcatcggcattacggtc
Rcagaatgcattgctggcttgcaggaggagctagagaggaagttgtatga
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.