Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c39690_264

[ Printable Version ]  [ Submit comment/correction ]

Sequence
RAC875_c39690_264
Contig
2DL_9894863
Probe
RAC875_c39690_264
DNA Homology
2DL_9894863Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442DL_9894863Best IWGSC match
DNA
aaaccaatattgctggcatggggggagtcggacaagtacctaccgctctc
Ratagccgaggagttcaagaaaaacaatccatcagtggtgaaactgaagc
c
BLAST
BLAST Search