Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c42283_686

[Submit comment/correction]

Sequence
RAC875_c42283_686
Contig
1AL_3884777
Probe
RAC875_c42283_686
DNA Homology
1AL_3884777Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-411AL_3884777Best IWGSC match
DNA
atggccgccaatcgcctagttgtttcgtctgcctgtattattcgtgtttc
Rtgtaaataacagcaatatcgtgcgtgttcgcctgcacaggtgatcagta
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.