Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c46735_674

[Submit comment/correction]

Sequence
RAC875_c46735_674
Contig
2BS_5193970
Probe
RAC875_c46735_674
DNA Homology
2BS_5193970Best IWGSC match1764.99983e-42URGI_BestIWGSC_N
BLAST, e-value
4.99983e-422BS_5193970Best IWGSC match
DNA
ttgtatctgctgccagtaggaaaagacatgaaggcggtgatattaggtag
Rgccatcactgcatgttccatcaatattgaccatgatttcatcgtctaaa
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.