Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c54366_845

[Submit comment/correction]

Sequence
RAC875_c54366_845
Contig
7BS_3036875
Probe
RAC875_c54366_845
DNA Homology
7BS_3036875Best IWGSC match1829.94922e-44URGI_BestIWGSC_N
BLAST, e-value
9.94922e-447BS_3036875Best IWGSC match
DNA
gagaacggtagtaagaatcatcagatgaaggagccaaatggtggtaatac
Rctagtgggacatgccgaggctctggtacagaaggcgcatagtgaggccc
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.