Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c5546_2773

[Submit comment/correction]

Sequence
RAC875_c5546_2773
Contig
6BS_2991213
Probe
RAC875_c5546_2773
DNA Homology
6BS_2991213Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446BS_2991213Best IWGSC match
DNA
ccaccatttccgttaagaacatcttgctcaatctcggaaaggcaacagcc
Rcctgggttggatgaagaccatggtggtggtagggctgcatgaattcagg
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.