Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c744_1935

[Submit comment/correction]

Sequence
RAC875_c744_1935
Contig
3AL_4446417
Species
Triticum aestivum
Probe
RAC875_c744_1935
DNA Homology
3AL_4446417Best IWGSC match1111e-22URGI_BestIWGSC_N
BLAST, e-value
1e-223AL_4446417Best IWGSC match
DNA
aataggaagcagccgtgatagaatggtggtcaccactggtgatgaagttt
Mttggccgaacttcattgccagttccccgatgatccagcatgcattgttt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.