Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c754_120

[Submit comment/correction]

Sequence
RAC875_c754_120
Contig
4AS_5951870
Probe
RAC875_c754_120
DNA Homology
4AS_5951870Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444AS_5951870Best IWGSC match
DNA
gtgctacaaaaatttagtaaattctcacagatccggtatttatctacacc
Rtgtgcatgtgtagaatcaggatatgtacggaacaacttctcattattca
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.