Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_c77384_313

[Submit comment/correction]

Sequence
RAC875_c77384_313
Contig
1AL_3976804
Species
Triticum aestivum
Probe
RAC875_c77384_313
DNA
gagaagacatagagagccaatgtgatggcacacaagaaaacaatgagccg
Racaaggatgcccagggattccaagtaaacacactctcaactatgtcacc
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.