Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_rep_c107892_142

[ Submit comment/correction ]

Sequence
RAC875_rep_c107892_142
Contig
6AS_4404757
Probe
RAC875_rep_c107892_142
DNA Homology
6AS_4404757Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-426AS_4404757Best IWGSC match
DNA
ggcgtctcccaggatgcaattcttgagagggtgaactccaagagcaagtc
Maaatcctatcagctcggccacaggctgtccctgaaatggagcactggaa
a
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.