Query (optional)   in Class  

GrainGenes Sequence Report: RAC875_rep_c120644_74

[ Printable Version ]  [ Submit comment/correction ]

Sequence
RAC875_rep_c120644_74
Contig
1AL_1065975
Probe
RAC875_rep_c120644_74
DNA Homology
1AL_1065975Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441AL_1065975Best IWGSC match
DNA
aactgtcagctattcctttgacattactgtatttccatggtgacttgtgg
Rcccgtatttcattcgtgacctttttcaatcacctcgtaagtgcccaagg
a
BLAST
BLAST Search