Query (optional)   in Class  

GrainGenes Sequence Report: RFL_Contig2394_439

[Submit comment/correction]

Sequence
RFL_Contig2394_439
Contig
3DL_6951980
Probe
RFL_Contig2394_439
DNA Homology
3DL_6951980Best IWGSC match1829.94922e-44URGI_BestIWGSC_N
BLAST, e-value
9.94922e-443DL_6951980Best IWGSC match
DNA
aaggcaaagcttctcaaggctaaagcgttgctagcactgaaagactattc
Raatgttatttcggagacaggatttattctcaaggaagatgaagataact
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.