Query (optional)   in Class  

GrainGenes Sequence Report: RFL_Contig2484_1065

[Submit comment/correction]

Sequence
RFL_Contig2484_1065
Contig
1DL_2234547
Probe
RFL_Contig2484_1065
DNA Homology
1DL_2234547Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441DL_2234547Best IWGSC match
DNA
cagaaatcgaggctgagaagttcccagtctcaaccaccgaagtggaaatc
Rtcgacaagtcagtgatcgaagaagagctgttgtcagtgaaagataaaat
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.