Query (optional)   in Class  

GrainGenes Sequence Report: RFL_Contig3780_644

[Submit comment/correction]

Sequence
RFL_Contig3780_644
Contig
2AL_6419693
Probe
RFL_Contig3780_644
DNA Homology
2AL_6419693Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442AL_6419693Best IWGSC match
DNA
ggcttagcggtagagggagccacccttgattaaccccacgaaatcaccct
Rtcttcttagtacgcatcacacgcatatatctgggaccccatgctaatct
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.