Query (optional)   in Class  

GrainGenes Sequence Report: RFL_Contig5576_761

[ Printable Version ]  [ Submit comment/correction ]

Sequence
RFL_Contig5576_761
Contig
1AL_1927657
Species
Triticum aestivum
Probe
RFL_Contig5576_761
DNA
CCGTTGATCTGGAGTGGCGAGGCGGTGGCGGTCTACTGTACAATACTGCA
MCGCACTGTACTGTGCGTAGCAGAGCAGGGATGGCAGCTGGTCGGTGACA
T
BLAST
BLAST Search