Query (optional)   in Class  

GrainGenes Sequence Report: Ra_c23068_380

[Submit comment/correction]

Sequence
Ra_c23068_380
Contig
1BS_3451673
Probe
Ra_c23068_380
DNA Homology
1BS_3451673Best IWGSC match1435e-32URGI_BestIWGSC_N
BLAST, e-value
5e-321BS_3451673Best IWGSC match
DNA
gcatccccaacaaagatctcctggatggcacacaactgcagttcaagtcc
Rtgacgcagaatgcgttcgtggctgccgagaatggcggcggcgcagcgtt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.