Query (optional)   in Class  

GrainGenes Sequence Report: Ra_c491_902

[Submit comment/correction]

Sequence
Ra_c491_902
Contig
4BS_2680108
Probe
Ra_c491_902
DNA Homology
4BS_2680108Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-444BS_2680108Best IWGSC match
DNA
gcgcgcacggtgctacgggagttcgccgcggagatgatggagaggaggaa
Ratgaatacgtgttttgttggtaatgaagatgaacaagaggatggggata
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.