Query (optional)   in Class  

GrainGenes Sequence Report: Ra_c6065_1145

[Submit comment/correction]

Sequence
Ra_c6065_1145
Contig
6DS_2114081
Probe
Ra_c6065_1145
DNA Homology
6DS_2114081Best IWGSC match1764.99983e-42URGI_BestIWGSC_N
BLAST, e-value
4.99983e-426DS_2114081Best IWGSC match
DNA
ctccgtctgtgacaccacctaccggtgctaggttctttgtgcccacggcg
Rctgctgtcgctgcagagcagatgcctagccaatcagtggagacacgtgg
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.