Query (optional)   in Class  

GrainGenes Sequence Report: Ra_c6728_590

[Submit comment/correction]

Sequence
Ra_c6728_590
Contig
2BS_5131713
Probe
Ra_c6728_590
DNA Homology
2BS_5131713Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BS_5131713Best IWGSC match
DNA
gatagtcccgtatgaaaacatccctgccgtagccgacaacatagaagcta
Raagaccgcttacggtgagacattgttacacgggttacgggcacaactga
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.