Query (optional)   in Class  

GrainGenes Sequence Report: Ra_c6993_1750

[Submit comment/correction]

Sequence
Ra_c6993_1750
Contig
5DS_2735819
Probe
Ra_c6993_1750
DNA Homology
5DS_2735819Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445DS_2735819Best IWGSC match
DNA
gatcgtgcttgttagtcttgtcatctgatgaaattgctttggcatcaagc
Rcggtgtttaatcttctcatgatacgaggcattaaaactataatagctag
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.