Query (optional)   in Class  

GrainGenes Sequence Report: TP13664

[ Printable Version ]  [ Submit comment/correction ]

Sequence
TP13664
Locus
TP13664
Species
Aegilops umbellulata
BLAST, e-value
1e-21chr3DIWGSC_v0.4_match
DNA
tgcagcattttcgtactctgattgtcttgtcaagcgagccagagtaaagc
cttgttggcgagac
BLAST
BLAST Search