Query (optional)   in Class  

GrainGenes Sequence Report: TP25264

[ Printable Version ]  [ Submit comment/correction ]

Sequence
TP25264
Locus
TP25264
Species
Aegilops umbellulata
DNA
tgcagctgagagttcaacttgtggctgtctgaggcggagggatggatggt
gatcaatcgagcgg
BLAST
BLAST Search