Query (optional)   in Class  

GrainGenes Sequence Report: TP29323

[ Printable Version ]  [ Submit comment/correction ]

Sequence
TP29323
Locus
TP29323
Species
Aegilops umbellulata
DNA
tgcaggagcaacagctcggagggtgctggtctcccaaccttccgaaaaaa
aaaaaaaaaaaaaa
BLAST
BLAST Search