Query (optional)   in Class  

GrainGenes Sequence Report: TP9814

[ Printable Version ]  [ Submit comment/correction ]

Sequence
TP9814
Locus
TP9814
Species
Aegilops umbellulata
DNA
tgcagcacatgaaaggcccattcccgttgctcgtgcacgatcttggcaac
cgtacagatgactg
BLAST
BLAST Search