Query (optional)   in Class  

GrainGenes Sequence Report: TP988

[ Printable Version ]  [ Submit comment/correction ]

Sequence
TP988
Locus
TP988
Species
Aegilops umbellulata
BLAST, e-value
0.000000000000002chr3DIWGSC_v0.4_match
DNA
tgcagaacatctacctttacaagaacgcgctgtcgggctccatcccgaaa
aaaaaaaaaaaaaa
BLAST
BLAST Search