Query (optional)   in Class  

GrainGenes Sequence Report: Ta.100.1.S1_at

Sequence
Ta.100.1.S1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AJ577386
[ Show all 19 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
tttttgctctcccactgctcgcccctcctgctcggctgctgcttccccac
accgcccaggtagctccaccgccggtggctcgctatacccaccacctccg
ccgcttccttcctcctcgtgcaggggaggtgcagaaacaccctagatcnc
tcccgcgagcgcgcatnnnnncntccnccgatgagcagccnaagccgccc
gagcctcccgcggcngccgtggctgtggccaccnccgcgccgcagtccca
cncagagtgggccgcctcgatgcaggcgttctacgcntccggggggcatc
cctacgccgcctggcccgcgcagcanctgatggcggcggcggcggcctca
gggacatcgtacggcgcgccggtgccgttccccatgtaccacccgggggc
cgcgatggcgtactacgcccacgcgtccatggccgcgggtgttccttacc
cgactgctgaagctgttgctgccgccgccgctgcgccagttgtggcagaa
gggaagggcaaggctaagggcggtggcctgtcttctgagaagggcagttc
tgctgcgccctctggcgacgacgcttcgcagagctgtgacagcggcagcg
angagtcnncagacacgagagattatgacactgaccaaaaggattcgtct
gcacctaagaagaggaaatctggtaatacctcagcggaaggtgaaccgtc
tcaagctgctgctgttccatatgctgctgtcgagtcaccgtatcagttga
aggggaggtctgcctcnaagcttccagtttctgcncctgggcgggcagca
cttcccaatgccacgccaaatctgaacatagggattgatctttggagtgc
ttctcaatccttagctgtgatcccagtgcagggggaagcaaatcctgggt
tggcncttgcccgatgtgatggtgttggtcagctggatgagcgtgaaatt
aagagggagaggcgaaaacaatctaatagggagtctgcgaggagatcaag
gttacgcaagcagcaagagtgcgaggaattatcnaggaaggttgctgagc
tgacaacagagaacaacgccctcagaactgagcttgaccagcttaagaag
gcctgtgaagatatggaagcacanaatgcacnactaatgtctcaggaacc
tgcngcggtcacaaccacactgggcatgagcatcgcagcgcccaaagtgc
agcancacgatgatgagggtaancttcataagaaggctaataataacagc
aacgggaagtacgtaggtggcagccacaaactggaggctaaccctaggtg
agagaccccacgagggagtgacagagatgagatgtggtgttcctttatct
aaccacaacacccatcatcgattcagtgtgctttttagcaaagatgatgt
tttagtccacttctcacagctcaccgggggccctgtagagttgccccgtc
gcagccatgtattatttntggctcgttgccgagaagaatgtgtaaactga
ttggtgtacctagagcttagaaattttatgtttgctaacttttcatgagg
attcatataaccngnnaatttgatggcctgatcggntnannanannnnna
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
n
BLAST
BLAST Search