Query (optional)   in Class  

GrainGenes Sequence Report: Ta.100.1.S1_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.100.1.S1_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
[ Hide all but 1 of 19 ]
AJ577386
AJ613078
AJ613657
BE516323
BJ209357
BJ214116
BJ216784
BJ221599
BU672316
CA653673
CD897110
CD925425
CD930947
CK156617
CK158060
CK161191
CK206782
CK207071
D64051.1
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
tttttgctctcccactgctcgcccctcctgctcggctgctgcttccccac
accgcccaggtagctccaccgccggtggctcgctatacccaccacctccg
ccgcttccttcctcctcgtgcaggggaggtgcagaaacaccctagatcnc
tcccgcgagcgcgcatnnnnncntccnccgatgagcagccnaagccgccc
gagcctcccgcggcngccgtggctgtggccaccnccgcgccgcagtccca
cncagagtgggccgcctcgatgcaggcgttctacgcntccggggggcatc
cctacgccgcctggcccgcgcagcanctgatggcggcggcggcggcctca
gggacatcgtacggcgcgccggtgccgttccccatgtaccacccgggggc
cgcgatggcgtactacgcccacgcgtccatggccgcgggtgttccttacc
cgactgctgaagctgttgctgccgccgccgctgcgccagttgtggcagaa
gggaagggcaaggctaagggcggtggcctgtcttctgagaagggcagttc
tgctgcgccctctggcgacgacgcttcgcagagctgtgacagcggcagcg
angagtcnncagacacgagagattatgacactgaccaaaaggattcgtct
gcacctaagaagaggaaatctggtaatacctcagcggaaggtgaaccgtc
tcaagctgctgctgttccatatgctgctgtcgagtcaccgtatcagttga
aggggaggtctgcctcnaagcttccagtttctgcncctgggcgggcagca
cttcccaatgccacgccaaatctgaacatagggattgatctttggagtgc
ttctcaatccttagctgtgatcccagtgcagggggaagcaaatcctgggt
tggcncttgcccgatgtgatggtgttggtcagctggatgagcgtgaaatt
aagagggagaggcgaaaacaatctaatagggagtctgcgaggagatcaag
gttacgcaagcagcaagagtgcgaggaattatcnaggaaggttgctgagc
tgacaacagagaacaacgccctcagaactgagcttgaccagcttaagaag
gcctgtgaagatatggaagcacanaatgcacnactaatgtctcaggaacc
tgcngcggtcacaaccacactgggcatgagcatcgcagcgcccaaagtgc
agcancacgatgatgagggtaancttcataagaaggctaataataacagc
aacgggaagtacgtaggtggcagccacaaactggaggctaaccctaggtg
agagaccccacgagggagtgacagagatgagatgtggtgttcctttatct
aaccacaacacccatcatcgattcagtgtgctttttagcaaagatgatgt
tttagtccacttctcacagctcaccgggggccctgtagagttgccccgtc
gcagccatgtattatttntggctcgttgccgagaagaatgtgtaaactga
ttggtgtacctagagcttagaaattttatgtttgctaacttttcatgagg
attcatataaccngnnaatttgatggcctgatcggntnannanannnnna
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
n
BLAST
BLAST Search