Query (optional)   in Class  

GrainGenes Sequence Report: Ta.1018.2.S1_x_at

Sequence
Ta.1018.2.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AL827092
[ Show all 62 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE442694
BE495028
BG262527
BE426304
DNA
aaccgcnnnnncnntnagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnncnnnnnnncgcgccccgtttattattccccttcgcgcag
ccgcccccgtgtctcccgtgcgcaccttctcgaagcctcccccatggcgg
accagctcaccgacgagcagatcgccgagttcaaggaggccttcagcctc
ttcgacaaggatggcgacggttgcatcaccaccaaggagcttggaaccgt
gatgcggtccctcgggcagaaccccacggaggcggagctgcaggacatga
tcaacgaggttgacgcggacggcaacggcaccatcgacttccccgagttc
ctgaacctgatggcgaggaagatgaaggacacggactcggaggaggagct
caaggaggcgttccgcgtgttcgacaaggaccagaacggcttcatctcgg
cggcggagctgcgccacgtgatgaccaacctcggggagaagctgacggac
gaggaggtggacgagatgatccgggaggcggacgtggacggcgacggcca
gatcaactacgaggagttcgtcaaggtcatgatggccaagtgaggtggcg
gcgggacaggggtcttccctcccacgaaataagcttaaaattcaagtgga
ttggaatgccagacagactcgcgtggttgtattttgtgctatgtttttta
aggatactgttgcctgttgggtagttggtcgggttatctatcttgtagcg
gtgtagtcttgggggagcagcatcggaattactacctggtttcttttggt
tgtggcacttatcttgttcgtcttatcangnaatttaggggcgttgtgcn
nnnnnnnnntnnnnnnntgcannnnnnnnnnnnncttggtttgtgttcag
cnccaaa
BLAST
BLAST Search