Query (optional)   in Class  

GrainGenes Sequence Report: Ta.1018.2.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.1018.2.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
[ Hide all but 1 of 62 ]
AL827092
BE426304
BE442647
BE516874
BG314362
BJ209545
BJ211130
BJ213789
BJ216251
BJ216987
BJ218497
BJ221293
BJ236494
BJ241751
BJ268118
BJ269119
BJ273040
BJ274057
BJ278564
BJ278705
BJ279709
BJ281063
BJ283618
BJ283757
BJ286125
BJ289677
BJ290428
BJ296007
BJ296986
BJ297241
BJ300376
BJ306178
BJ313776
BJ313840
BJ313960
BJ314014
BQ294870
CA607500
CA629434
CA653645
CA660973
CA700734
CA705841
CA719950
CA719983
CA720187
CA720827
CD864792
CD864793
CD881208
CD881981
CD881982
CD934802
CD934803
CK163402
CK165953
CK166147
CK194162
CK204110
CN009121
CN009211
CN011092
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA Homology
BE442694
BE495028
BG262527
BE426304
DNA
aaccgcnnnnncnntnagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnncnnnnnnncgcgccccgtttattattccccttcgcgcag
ccgcccccgtgtctcccgtgcgcaccttctcgaagcctcccccatggcgg
accagctcaccgacgagcagatcgccgagttcaaggaggccttcagcctc
ttcgacaaggatggcgacggttgcatcaccaccaaggagcttggaaccgt
gatgcggtccctcgggcagaaccccacggaggcggagctgcaggacatga
tcaacgaggttgacgcggacggcaacggcaccatcgacttccccgagttc
ctgaacctgatggcgaggaagatgaaggacacggactcggaggaggagct
caaggaggcgttccgcgtgttcgacaaggaccagaacggcttcatctcgg
cggcggagctgcgccacgtgatgaccaacctcggggagaagctgacggac
gaggaggtggacgagatgatccgggaggcggacgtggacggcgacggcca
gatcaactacgaggagttcgtcaaggtcatgatggccaagtgaggtggcg
gcgggacaggggtcttccctcccacgaaataagcttaaaattcaagtgga
ttggaatgccagacagactcgcgtggttgtattttgtgctatgtttttta
aggatactgttgcctgttgggtagttggtcgggttatctatcttgtagcg
gtgtagtcttgggggagcagcatcggaattactacctggtttcttttggt
tgtggcacttatcttgttcgtcttatcangnaatttaggggcgttgtgcn
nnnnnnnnntnnnnnnntgcannnnnnnnnnnnncttggtttgtgttcag
cnccaaa
BLAST
BLAST Search