Query (optional)   in Class  

GrainGenes Sequence Report: Ta.1258.1.S1_a_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.1258.1.S1_a_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AJ609851
[ Show all 258 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
cccccgctattgcgattaaggccnnncnnnnnnncnnnnntnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnannnnnnnnnnagnncnnnnnnncnnnnnnnnnnnnnncncnncnn
ncccncnncnncnnnncnannncnnnnncnncnaccttctccatggcgct
ctccgtggagaagaccncgtncgggccgggagtacaaggtnaaggacctc
tcccaggccgacttcggccgcctcgagctcgagctcgccgaggtcgagat
gccnggcctcatggcctgccgcnccgagttcggnccctcgcagcccttca
agggcgcccggatctccggctccctccacatgaccatccagaccgccgtn
ctcatcgagaccctcaccgccnctcggcgccgaggtccgctggtgctcct
gcaacatcttctccacccaggaccacgccgccgccgccatcgcnccgcga
ctcngcngccgtcttcgcctggaagggcgagaccctcgaggagtactggt
ggtgcaccgagcgctgcctcgactggggcgncggcggcggccccgacctc
atcgtcgacgacggcggngacgccacgctgctcatccacgagggcgtcaa
ggccgaggaggagttcgagaantccggcaaggtncccgacccggngtcca
ccgacaaccccgagttcaagatcgtnctcaccatcatccgcgacgggctc
aagaccgacgccnngcaagtaccgcaagatgaaggagaggctcgtcggng
tntccgaggagaccaccaccggcgtcaagaggctctaccagatgcaggag
tccggcaccctcctcttccccgccatcaacgtcaacgactccgtcaccaa
gagcaagtttgacaacctttacggttgccgtcactcgctccctgatggtc
ttatgagggccactgatgttatgatcgccggcaaggtngccgtggtctgc
ggttanggtgatgttggcaagggctgtgccgccgcactnaagcaggctgg
tgcccgtgtgatcgtgacagagattgaccccatntgtgcccttcaggccc
tngatggagggnatccagatcctcaccttggaggatgttgtctctgaggc
tganatctttgtgaccaccaccggaaacaaggacatcatcatggtngacc
acatgaggaagatgaagaacaacgccattgtctgcaacattggtcacttn
gacaangagatncgacatgaacggccttgagacctaccctggtgtcaagc
gcatcaccatcaangccccangactnngaccgntgggtncttccccngag
accaagacnggncatcattgttcttngcntgagggntcgtcntgantgaa
nccttggnatgtgccanctggnccaccccnnagctttgntcatgtccntg
ctcattcacnaanccanggttnattgctcnagcttgnagttngtggnaac
gnagnnaggccnannggcaangtangagnnaagaannggtgtancgttct
nnccccaagcnacctngnnacgagaanggtncgcggcccntccnnacttn
gggcaangctcggncgnnccaggnctngaccaangctncaccaagtcccn
agtctngactacattagcatcccannttgagggtccnttancaagcctgc
ggcnttaccggtactangtgtgtccagcangnactagcggnctggcctga
gccntgagtcggnagncangcggcaccaacgggaactctnatcaactatc
ctgtttcccttctattatcttacatgctgtctcttaggcggaggatttgt
tattatggttatgttttgagccttgtgagggttgggagaggcggcgtttg
cttttgcccagaaataatggcattattattggtttaannnnannannnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnncnnnnnnnnnan
ntnnnnnnnaanctnnnnnnnnnatnttnnnnnnnnnnnnnnnnnntnnn
nnnnnnnnnnnnnaannannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnannnnnntnnnnnag
ctggta
BLAST
BLAST Search